Cy5 labeled
WebNCI-N87 cells (3 × 10 5) were treated with Cy5-labeled aptamers (cy5-HER2aptctl, cy5-HER2apt14, and cy5-HER2apt28) and DAPI, and incubated at 37 °C for 2 h. The representative are merged images of DIC, DAPI, and Cy5. Internalization of aptamers was visualized using an LSM 780 confocal microscope. Representative fluorescent images … WebCy 3: A standard orange-fluorescent label for nucleic acids used in imaging, flow cytometry, and genomic applications. Cy 5: A standard far red-fluorescent label for nucleic acids used in imaging, flow cytometry, and genomic applications. Cy 5.5: Used as a fluorescent label in 5' nuclease probes for qPCR, Scorpion ® primers (Premier Biosoft), and Molecular …
Cy5 labeled
Did you know?
WebProduct overview. Cy5 ® Conjugation Kit / Cy5 ® Labeling Kit (ab188288) uses a simple and quick process for Cy5 labeling / conjugation of antibodies. It can also be used to conjugate other proteins or peptides. Learn about our … WebJan 21, 2024 · The cellular internalization of Cy5-labeled CMD-TMC-NPs and CMD-TCs-NPs were reconfirmed and compared by flow cytometric analysis in the Y79 cells. To execute, the cells were cultured in a 6-well plate at a density of 250 × 10 4 cells/well. After 24 hr of incubation, the cells were treated with Cy5-labeled NPs at 37ºC for 2 hr.
Web1 hour ago · For the labeling, a secondary dual-Cy5-conjugated imager-oligo was ordered at a concentration of 100 µM (MERCK KGaA) with sequence (5″ to 3″): [Cy5]AATGCATGTCGACGAGGTCCGAGTGTAA[Cy5]. Just before labeling of SARS-CoV-2-infected cells, the primary oligo solution was hybridized with the secondary imager … WebMar 1, 2015 · The exceptions are three Cy5 parameters, Cy5–AA/TT, Cy5–CC/GG, and Cy5–GC/CG, where the stabilization is characterized by favorable decrease of entropic cost for duplex formation. The contributions of various forces (electrostatic, dispersion, hydrophobic, and van der Waals) are likely to be specific for each dye and sequence …
WebThe dye color is very intense, therefore quantities as small as 1 nmol can be detected in gel electrophoresis by naked eye. This Cyanine5 NHS ester (analog to Cy5 ® NHS ester) is a reactive dye for the labeling of amino-groups in peptides, proteins, and oligonucleotides. This dye requires a small amount of organic co-solvent (such as DMF or ... WebApr 10, 2024 · B) Semiquantitative analysis of penetration depth into cartilage in Cy5-LNP/Cy5-cLNP and block group (n=6). C) Quantification of the AUC based on the fluorescence intensity profiles (n = 6). D) Representative fluorescence images of mouse femoral heads incubated with Cy5-labeled rIGF-1 (0.2 mg/ml) with or without aggrecan …
WebJul 10, 2024 · To further investigate the fate of liposomes, dual-label cRGDLs or PLs (Cy5-NBD-cRGDLs or Cy5-NBD-PLs) were administered to I/R rats 12 hours after reperfusion. The colocalization of Cy5 and NBD-PE in the ischemic hemisphere was consistently observed outside cerebral vessels for cRGDLs, whereas PLs were mainly confined in the …
WebCy5 Labeling. Cy5/ Cyanine 5 are popular fluorescent dyes compatible with various detection techniques and standard filters. This class includes far-red fluorescence-emitting dyes with excitation/emission maximum 646/662 nm. Cyanine Acid. new york field tripWebThis Cy5-labeled cGAMP provides an excellent probe for developing fluorescence-based assays and test for detecting cGAMP and monitoring its activity. Calculators. Common stock solution preparation. Table 1. Volume of DMSO needed to reconstitute specific mass of 2',3'-cGAMP-Cy5 conjugate to given concentration. milford cafe aucklandWebCy5 synonyms, Cy5 pronunciation, Cy5 translation, English dictionary definition of Cy5. n. Any of various blue dyes, used to sensitize photographic emulsions to a greater range of light. milford camera hoursWebApr 3, 2024 · Lind et al. described the combination of the nonspecific dsDNA binding dye BOXTO with sequence-specific FAM-labeled TaqMan and LNA probes , and Cheah et al. described a two-tube combined TaqMan/SYBR green assay with a ROX- and a Cy5-labeled probe . For those applications, they needed to combine specific sequence detection by … new york field office usfwsWebCyDye ™ labeled nucleotides are available in a range of bright, intense colors with narrow emission bands, well suited for multiplexing within a single sample. Packaging 1 pkg Features and Benefits High sensitivity. Low nonspecific binding. High photostability. High water solubility. pH insensitive. Analysis Note new york fighting game communityWebThe images show the Cy5 labeled mRNA (red), eGFP (green), and DAPI (blue) signal 48 h after injection of the polymer formulations containing 1 µg of either Cy5 labeled mRNA or eGFP expressing mRNA using the hollow microneedle MicronJet™600 injector. ( a ) Cy5 labeled mRNA signal going from a skin depth of 10 to 400 µm. new york field museumWebMar 28, 2024 · Then, 2 μL Cy5-CpG 1826 (Cy5-TCCATGACGTTCCTGACGTT, 1 μM, GenScript, China) was added into the cultured medium and incubated for another 4 h [39,40]. The excessive Cy5-CpG 1826 was removed by washing with PBS for 3 times before the addition of FITC labeled PDA NPs (50 μg/mL) or not. milford camera inc on ebay